임상검체에서 PCR을 이용한 헤르페스 바이러스의 검색
- Author(s)
- 전세진; 김기산; 백원기; 서성일; 서민호
- Keimyung Author(s)
- Kim, Ki San; Baek, Won Ki; Suh, Seong Il; Suh, Min Ho
- Department
- Dept. of Ophthalmology (안과학)
Dept. of Microbiology (미생물학)
- Journal Title
- 대한안과학회지
- Issued Date
- 1996
- Volume
- 37
- Issue
- 12
- Abstract
- The rapid and sensitive diagnostic methods for herpes simplex virus (HSV) infection have been developed . In this study, we employed the polymerase chain reaction (PCR) technique with primer 5 CATCACCGACCCGGAGAGGGAC 3 for detection HSV DNA from specimens obtained from the corneal lesion of patients who were suspected of HSV keratitis. The products of PCR was confirmed with agarose gel electrophoresis and southern blot hybridization. Positive results were obtained 4 of 7 typical lesions (2 of 5 dendritic lesions and 2 of 2 geographic lesions) and 7 including 4 without a history of herpetic keratitis of 17 atypical lesions. With these results we could find that PCR technique would be a useful tool for the detection of HSV DNA in both typical and atypical lesion of herpetic keratitis as well as in cases hard to diagnose clinically.
Herpes simplex virus(HSV) 감염을 진단하기 위하여 빠르고 민감도가 높은 방법들이 개발되어져 왔다.본 연구에서 저자들은 HSV 각막염이 의심되는 환자의 각막병소 부위를 긁어서 가검물을 채취한후 HSV DNA를 검색하기위해 Primer 5 CATCACCGACCCGGAGAGGGAC 3를 이용해서 Polymerase chain reaction (PCR)을 시행하였다. PCR의 산물은 agarose gel electrophoresis와 Southern blot hybridization으로 확인하였다. 전형적인 HSV각막염의 병소를 보이는 7안중 4안과 비전형적인 양상을 보이는 17안중 7안에서 PCR양성을 보였고,후자의7안중 4 안의 경우에는 HSV각막염의 기왕병력이 없었다. 결과적으로 임상양상이나 기왕의 병력만으로 간과 될 수 있는 HSV각막염 진단에 PCR을 협조적으로 시행한다면 정확한 진단과 조기에 치료적 방향을 설정할 수 있는 유용한 방법이 될것으로 생각된다.
- Authorize & License
-
- Files in This Item:
-
Items in Repository are protected by copyright, with all rights reserved, unless otherwise indicated.